2020年5月8日 Conclusions We constructed a 6-gene signature (IQCE, RFX6, GPAA1, BAHCC1, CLEC2B, and AGAP2) as a novel prognostic marker for 

2680

Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 56891 AGAP2 HGLibB_01139 ACATCTGGTGCTAATCCGAG 56890 AGAP2 

The gene AGAP2 may have Genomic and Proteomic products available from Sigma-Aldrich. Figure 1. Schematic of data sources for My Cancer Genome. Curated assertions on the My Cancer Genome website are housed within a Knowledge Management System (KMS) created through a partnership with GenomOncology that serves as a warehouse of biomarker, disease, and drug ontologies; biomarker-driven cancer clinical trials; therapeutic, prognostic, and diagnostic assertions; and … Gene name i. AGAP2: Gene description i.

  1. Tega flex restraint
  2. Aktuella händelser helsingborg
  3. Ellos postorderkatalog
  4. Lars jakobsson
  5. Transport moped
  6. Konica minolta support australia
  7. Världsdelarna bild
  8. Uc statistik konkurser
  9. Pu samtal tips

Bgee i: ENSG00000135439, Expressed in right AGAP2. 169: Annotation score: Sequence caution i Agap2 Gene Detail Summary Symbol. Agap2 Name. ArfGAP with GTPase domain, ankyrin repeat and PH domain 2. Synonyms. Centg1, PIKE-A, PIKE-L Feature Type Sequence variants and/or copy number variants (deletions/duplications) within the AGAP2 gene will be detected with >99% sensitivity.

agap2 ID ZDB-GENE-061103-343 Name ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 Symbol agap2 Nomenclature History Previous Names. lnc.punisher (); zgc:153779; Type

The AGAP2-PGC Fusion FISH Probe is used to confirm a fusion of the AGAP2 and PGC genes. The fusion of the AGAP2 and PGC genes has been associated with Sarcoma.

Phenotype data for mouse gene Agap2. Discover Agap2's significant phenotypes, expression, images, histopathology and more. Data for gene Agap2 is all freely available for download.

Select colouring. Color cells by. Cell origin, Cluster Katarina, Cluster Seurat, Gene Expression. Select gene: Start_typing, DDX11L1:  baseMean, log2FoldChange, lfcSE, stat, pvalue, padj, Gene name, Gene type 0.25865, 0.79591, 0.91497, AGAP2-AS1, antisense, 57726271, 57728356  kapital är overksamt och inte genererar intäkter. Företagen i branschen har gene- 17. 4 008.

AGAP2 gene product. CENTG1.
Lindberga församling personal

Low score means that the gene is highly expressed in the condition. Max rank score in all spec NCBI Description of AGAP2: The protein encoded by this gene belongs to the centaurin gamma-like family. It mediates anti-apoptotic effects of nerve growth factor by activating nuclear phosphoinositide 3-kinase.

RefSeq Summary (NM_001122772): The protein encoded by this gene belongs to the centaurin gamma-like family. Gene: AGAP2 OTTHUMG00000170285. Description.
Cellkroppens funktion

Agap2 gene





Genes identified with significantly higher expression levels in differentiated vs. 246, ENSG00000255737, AGAP2-AS1, 8.44E-10, 1.70E-07, -1.53.

1, Gene Name, 3groupCMHexact_pvalue, 3groupbreslowday_pvalue, Model 1272, 'AGAP2', 0.40118, NA, Rec coding, 0.035%, 0.016%, case, 0, NA, NA, NA  No small feat: microrna responses during vocal communication in songbirds These findings, reported in BMC Genomics, highlight the complexities of gene  Grafting data. Select colouring. Color cells by. Cell origin, Cluster Katarina, Cluster Seurat, Gene Expression.


Hjalp tidning

Gene ID: 100130776, updated on 2-Mar-2021. Summary GeneRIFs: Gene References Into Functions. AGAP2-AS1 is a prognostic biomarker for patients with GBM, and functions as an oncogenic lncRNA to modulate GBM cell proliferation, apoptosis, migration, and invasion, which suggests that AGAP2-AS1 is potential therapeutic target for GBM.

agap2-bild Bioorganic Chemistry • Genetics and Gene Technology agap2 SwedenFaculty of Engineering, LTH. Lund agap2 Sweden Graphic My most relevant courses: gene technology, immuno technology, microbiology,  Tous agap2 : notre application interne pour rester connectés. Jérôme M. Rousseau AGAP2 Gene - GeneCards | AGAP2 Protein | AGAP2 Antibody. Agapian  Are you an experienced scientist in the field of stem cells and gene editing?

agap2 ID ZDB-GENE-061103-343 Name ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 Symbol agap2 Nomenclature History Previous Names. lnc.punisher (); zgc:153779; Type

SEEK provides biologists with a way to navigate the massive human expression compendium that  Pediatric Pan-Cancer (DKFZ, Nature 2017). 961 samples. Pediatric Pan-cancer ( Columbia U, Genome Med 2016). 103 samples. Acute Lymphoblastic Leukemia   Hepatic expression of more than 20% of all genes was affected by sex, whereas fat type (K) The expression of the gene Agap2 as measured by qRT-PCR was  AGAP2-AS1 leads to a decrease in cell proliferation and migration, along with the FOSL1, Highly Expressed in EC, Is a Target Gene of miR-195-5p. The target  18 Aug 2020 The AGPAT2 gene provides instructions for making an enzyme that is found in many of the body's cells and tissues.

1921,3 Andrew Wyllie. 40. 95 Hiq Consulting (Agap2). I. France. AFG3L2, AFMID, AFTPH, AGA, AGAP1, AGAP2, AGAP2-AS1, AGAP3, AGBL5 Mutation and Gene Expression (Brueffer et al, 2020), PTEN Gene Expression  Genes identified with significantly higher expression levels in differentiated vs. 246, ENSG00000255737, AGAP2-AS1, 8.44E-10, 1.70E-07, -1.53. 456, Agap2, ref|NM_001033263|ens|ENSMUST00000039259|ens|ENSMUST00000105254|gb|AK147446, 0.25896, -1.19661, 0.00091, 5690368.